rs73367261 chr12:85555103 G>C
- Sequence
aacattgtattgtcttaaatttca[G/C]ttacacaggagaaataagtttact
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.42 | -0.28 | 2.08 |
Items per page:
1 – 1 of 1