rs73380507 chr7:80210525 G>A
- Sequence
taaaacgacatgttttagtaggag[G/A]aggggtctctgttctctgccttca
- ASB in cell types
- 22RV1 (prostate carcinoma) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 4.18 | n/a | 2.00 | |||
| breast tumor | 3.01 | n/a | 2.00 |
Items per page:
1 – 2 of 2