rs734307 chr12:98397604 T>C
- Sequence
ttcaatttgaaagtgtacattaaa[T/C]aaatccaagtaagaggcaacaatc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia) tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.95 | 0.91 | 1.11 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.81 | 1.19 | 1.00 | |||
| tibial nerve | -0.65 | 1.09 | 1.00 |
Items per page:
1 – 3 of 3