rs73529608 chr8:10798976 T>A
- Sequence
caaattgtgcacaagcagcaatga[T/A]ttgatattagaaaaatgagtttgt
- ASB in cell types
- LUHMES (lund human mesencephalic cells) right lobe of liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LUHMES (lund human mesencephalic cells) | 1.64 | -1.20 | 1.00 | |||
| right lobe of liver | -1.48 | 1.76 | 1.00 |
Items per page:
1 – 2 of 2