rs73568971 chr8:27957998 G>A
- Sequence
caagcagtacacaaatggatgagc[G/A]tgtctgtgttccagtaaaacttta
- ASB in cell types
- 22RV1 (prostate carcinoma) LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.98 | -1.59 | 2.00 | |||
| LHSAR (prostate epithelial cells) | 0.48 | 1.49 | 2.00 |
Items per page:
1 – 2 of 2