rs73583957 chr16:80803387 A>T
- Sequence
tggcatctgtgtcctatgtcccca[A/T]cacctcagacttccacgttctcct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -2.76 | 2.97 | 1.00 | |||
| foreskin keratinocyte | 1.13 | -4.03 | 2.67 |
Items per page:
1 – 2 of 2