rs73776518 chr6:134124075 C>T
- Sequence
caacgtgctggatgcagggctaag[C/T]gcttcatgtgcattatctcacttg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -0.43 | 1.21 | 1.33 |
Items per page:
1 – 1 of 1