rs738802 chr22:23849894 A>G
- Sequence
gctgggccctgcctccctaggccc[A/G]ggtaacaggcattttctaagacag
- ASB in cell types
- LUHMES (lund human mesencephalic cells) T-ALL cells from peripheral blood HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LUHMES (lund human mesencephalic cells) | 1.71 | -1.12 | 1.00 | |||
| T-ALL cells from peripheral blood | 2.17 | n/a | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -1.62 | 2.39 | 2.00 |
Items per page:
1 – 3 of 3