rs73933904 chr19:41793296 A>G
- Sequence
cggaaagttctctgcgccgccagg[A/G]ggcgccatcataaaccacgtcggt
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.60 | 0.85 | 1.30 | 5.27 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
