rs73994793 chr17:65278445 C>T
- Sequence
gcccccttggagtctcaggtcatc[C/T]cgcaggcagggagcccagttgtga
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -1.21 | 1.22 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 1.62 | -0.98 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.27 | -1.00 | 1.00 |
Items per page:
1 – 3 of 3