rs7404397 chr16:57600496 A>C
- Sequence
gaaagggcagtgctgagtgtgggc[A/C]ctggggcaagggcctgaccaccga
- ASB in cell types
- D54 (H54, Human glioblastoma) erythroid cells KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| D54 (H54, Human glioblastoma) | 2.93 | -4.52 | 1.50 | |||
| erythroid cells | -4.98 | 3.09 | 1.50 | |||
| KMS-11 (Plasma cell myeloma) | -1.34 | 1.62 | 2.00 |
Items per page:
1 – 3 of 3