rs74046057 chr14:34461640 C>T
- Sequence
ctggcttaaaagctagttaactga[C/T]tagaattcttggtagacccaaagc
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.32 | 0.81 | 1.53 | |||
| HepG2 (hepatoblastoma) | 0.62 | 0.08 | 1.92 |
Items per page:
1 – 2 of 2