rs7405042 chr16:14382649 T>C
- Sequence
cctggcctgtcttcttttttttaa[T/C]tgaggtgaaactcacatgaaatta
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) SU-DHL-1 (Anaplastic large cell lymphoma)
- ASB for transcription factors
- GCR_HUMAN KAISO_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.52 | 2.30 | 1.58 | n/a | No Hit | |||
| KAISO_HUMAN | -4.97 | 2.88 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2