rs740601 chr22:19963240 T>G
- Sequence
agggccccaaggtgggcggttcgg[T/G]gattcagagagggcagctctgtgt
- ASB in cell types
- LNCaP C4-2 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2 (prostate carcinoma) | -0.24 | 2.23 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, serum creatinine, systolic blood pressure (sbp), triglycerides
GTEx eQTL Artery_Aorta, Colon_Transverse, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid