rs74299967 chr7:139359023 G>T
- Sequence
aaaacagtttttagaaacaccagg[G/T]aaaggctcagggctaagtatttta
- ASB in cell types
- K562 (myelogenous leukemia) primary B-CLL cells MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.05 | 0.74 | 1.51 | |||
| primary B-CLL cells | 1.91 | -5.34 | 3.00 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 0.84 | 0.05 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid