rs7436102 chr4:155026278 A>G
- Sequence
ttttgagggacatgcggcaacttc[A/G]gtggatatcatgtgaactgctact
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.26 | 0.22 | 1.10 | |||
| upper lobe of left lung | 2.42 | -2.08 | 1.00 |
Items per page:
1 – 2 of 2