rs7441736 chr4:69025451 C>T
- Sequence
agacccctgctggagactgtgtga[C/T]gttacatgggaggtggtgtttgtt
- ASB in cell types
- SYO-1(Biphasic synovial sarcoma) WA09 (embryonic stem cells) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SYO-1(Biphasic synovial sarcoma) | 3.21 | -3.35 | 1.00 | |||
| WA09 (embryonic stem cells) | 1.52 | -0.49 | 1.50 | |||
| pancreas | -0.15 | 0.89 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), rheumatoid arthritis, serum brain derived neurotrophic factor concentration
GTEx eQTL Breast_Mammary_Tissue, Colon_Transverse, Liver, Lung, Minor_Salivary_Gland, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid