rs74503308 chr11:116732841 G>A
- Sequence
aagaaggaagaaagaagagcaggc[G/A]cagctggagggtaggaagcatgaa
- ASB in cell types
- T47D (invasive ductal carcinoma) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.18 | 1.45 | 1.95 | |||
| epidermal keratinocytes | 2.90 | n/a | 2.00 |
Items per page:
1 – 2 of 2