rs74564687 chr15:97961301 T>C
- Sequence
ggcttccgggggtggggtccggcc[T/C]accctcgcgggtaaggagagaccg
- ASB in cell types
- MCF-7 C4-12 (invasive breast ductal carcinoma)
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 1.76 | 0.30 | 1.06 | -5.39 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
