rs747382 chr13:39274292 G>T
- Sequence
tctacagaaaacagttataaagat[G/T]cacccctacactaaagtgtgaaag
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 2.30 | -1.59 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.90 | 2.21 | 1.00 |
Items per page:
1 – 2 of 2