rs747723 chr15:59306850 T>G
- Sequence
ctcatgctcatgagttgctcatga[T/G]gtcattcatctcaaaaacctggtg
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 1.85 | n/a | 2.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hypertension (early onset hypertension), ldl cholesterol, spine bone mineral density (bmd)