rs74774984 chr4:179836893 G>T
- Sequence
tcacaatcccacttcatacatgtg[G/T]cttgacccttcttccactccccct
- ASB in cell types
- MV-4-11 (Childhood acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MV-4-11 (Childhood acute monocytic leukemia) | 0.32 | 1.33 | 1.12 |
Items per page:
1 – 1 of 1