rs74799659 chr6:34294775 T>G
- Sequence
atatctattttttcatcagagacc[T/G]ttcttctgacatttttattttgta
- ASB in cell types
- germinal center B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center B-cells | 2.35 | -1.58 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood