rs74883678 chr2:24123159 G>A
- Sequence
gtttcccgccactgccttccagtg[G/A]tttggtccccgagcaggacccaag
- ASB in cell types
- HEK293 (embryonic kidney) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.68 | 0.66 | 1.11 | |||
| breast tumor | 2.19 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Nerve_Tibial, Testis, Thyroid, Whole_Blood