rs7496487 chr15:26838763 T>C
- Sequence
gatttttaaatgtgtgatatatgt[T/C]ctctgatgcccacgtctcgtcgtt
- ASB in cell types
- VCaP (prostate carcinoma) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | n/a | 1.71 | 2.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -1.56 | 2.12 | 1.00 |
Items per page:
1 – 2 of 2