rs74972358 chr19:17261153 C>G
- Sequence
agcgtctccttgcagcccacgagg[C/G]cctacgcgatctgcatttgttctc
- ASB in cell types
- gastroesophageal sphincter MOLM-13(acute monocytic leukemia(AML), Homo sapiens) OCI-LY7 (diffuse large B-cell lymphoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastroesophageal sphincter | -1.59 | 1.85 | 1.00 | |||
| MOLM-13(acute monocytic leukemia(AML), Homo sapiens) | 2.76 | -4.99 | 2.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | -1.96 | 1.98 | 1.00 | |||
| foreskin keratinocyte | 0.63 | n/a | 2.67 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis