rs7501824 chr17:82441317 C>T
- Sequence
tgggtgaggggggcaggcatgggg[C/T]gggtgcaggtgagggggcaggtgt
- ASB in cell types
- keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 2.53 | n/a | 2.50 | -4.12 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, ldl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol, total cholesterol change with statins