rs7512834 chr1:29849199 C>T
- Sequence
ggtgccaccccagcatccctcctg[C/T]gcccttctgtatttcttagttact
- ASB in cell types
- MS-1 (Small cell lung carcinoma) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -0.67 | 1.40 | 1.00 | |||
| HeLa (cervical adenocarcinoma) | 0.40 | 1.53 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, hdl cholesterol, hdl cholesterol change with statins, parkinsons disease, refractive error, schizophrenia, sporadic creutzfeldt-jakob disease