rs751491 chr2:41854016 A>G
- Sequence
aataattctctacatttggttaac[A/G]cttcatgcacgtcaaactttccca
- ASB in cell types
- A549 (lung carcinoma) GM17942 (lymphoblastoid cell) vagina
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.47 | 0.77 | 1.06 | |||
| GM17942 (lymphoblastoid cell) | -1.75 | 1.75 | 1.00 | |||
| vagina | 2.46 | -2.49 | 1.00 |
Items per page:
1 – 3 of 3