rs7515374 chr1:206734678 A>C
- Sequence
tttggttgaaatcctggtaaagat[A/C]ccaggggagcaggttagtgtagta
- ASB in cell types
- THP-1 (acute monocytic leukemia) Kelly (neuroblastoma) CD34+ stem cells-derived erythroblasts neural cell
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.52 | 0.86 | 1.74 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, aortic valve calcium, resistance to kuru in aged women despite likely exposure