rs7516557 chr1:203290119 T>A
- Sequence
cttctgagactttctgggattctc[T/A]ggaaacacagatgccagtttttct
- ASB in cell types
- monocytes from periferal blood
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 2.21 | -1.47 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, total cholesterol