rs75181364 chr10:80599810 C>T
- Sequence
tccagcaggccgagtcacaaaagg[C/T]ctgtgtgatacccttcagcatctc
- ASB in cell types
- bipolar neuron PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -1.79 | 2.16 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 1.03 | -0.62 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Lung, Nerve_Tibial, Spleen, Testis, Thyroid, Whole_Blood