rs7519669 chr1:106268295 G>A
- Sequence
agtgcggaggtgactcctagtggg[G/A]gttggacacattgaacaataggga
- ASB in cell types
- testis GM18486 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| testis | -2.75 | 2.65 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.50 | -0.53 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.34 | -0.40 | 1.00 |
Items per page:
1 – 3 of 3