rs7525650 chr1:47319163 A>G
- Sequence
tgtaaaagaaaggaacgctgtgtc[A/G]gcttctcatgatttatgattttct
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- EMSY_HUMAN ZN316_HUMAN MEIS2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EMSY_HUMAN | 3.33 | -3.67 | 1.00 | n/a | n/a | |||
| ZN316_HUMAN | 2.26 | -1.95 | 1.00 | n/a | n/a | |||
| MEIS2_HUMAN | 2.30 | -1.98 | 1.00 | -3.78 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP birth weight, diastolic blood pressure (dbp), height, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid