rs7534426 chr1:160376511 T>A
- Sequence
gacaatccatgagatctactaaac[T/A]aaggatggagaaactgcagctgag
- ASB in cell types
- K562 (myelogenous leukemia) GM18526 (B – cells Lymphoblastoid Cell Lines) Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.90 | 0.11 | 2.01 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.44 | 0.79 | 1.00 | |||
| Peyer's patch | 2.08 | -1.64 | 1.00 |
Items per page:
1 – 3 of 3