rs7536827 chr1:146037054 T>A
- Sequence
atactctaaaggaatcaagcgtat[T/A]tcagatgcgttggtggtatagtgg
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line) CHL-1 (Melanoma)
- ASB for transcription factors
- IRF4_HUMAN ZN335_HUMAN CLOCK_HUMAN PBX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IRF4_HUMAN | -1.05 | 1.81 | 1.00 | n/a | No Hit | |||
| ZN335_HUMAN | -1.66 | 2.71 | 2.00 | n/a | No Hit | |||
| CLOCK_HUMAN | -1.55 | 2.61 | 2.00 | n/a | No Hit | |||
| PBX4_HUMAN | -2.56 | 2.48 | 1.00 | n/a | n/a | |||
| P66B_HUMAN | 2.47 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood