rs7539855 chr1:67532450 C>A
- Sequence
aatggggctaaaacttagacctac[C/A]ttttagggctgctttaaggagtaa
- ASB in cell types
- MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | -1.07 | 1.40 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, aortic valve calcium, height, parkinsons disease, total cholesterol, triglycerides