rs7542200 chr1:160376514 G>A
- Sequence
aatccatgagatctactaaactaa[G/A]gatggagaaactgcagctgaggag
- ASB in cell types
- K562 (myelogenous leukemia) GM18526 (B – cells Lymphoblastoid Cell Lines) Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.88 | 0.12 | 2.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.41 | 0.88 | 1.00 | |||
| Peyer's patch | 2.25 | -1.83 | 1.00 |
Items per page:
1 – 3 of 3