rs7547496 chr1:26363990 T>C
- Sequence
ctttgctaacgcactgagatgcgc[T/C]ccctgggcgccccctgctgggcga
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GBM39 (Human brain tumor) 2588 (Lymphoblastoid Cell Lines) K562 (myelogenous leukemia)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN ILF3_HUMAN KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.19 | -0.55 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.86 | 0.70 | 1.33 | 3.17 | Discordant | |||
| ILF3_HUMAN | 1.68 | -1.40 | 1.00 | n/a | n/a | |||
| KDM6A_HUMAN | 0.02 | 1.73 | 1.75 | n/a | n/a | |||
| JUN_HUMAN | 1.33 | 0.15 | 1.22 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Amygdala, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood