rs75489571 chr2:42089525 G>C
- Sequence
gcagaatgctgccccctagcgggc[G/C]gcccacatcctgggcagctcagga
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) THP-1 (acute monocytic leukemia) adrenal gland spleen
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.11 | 1.63 | 1.13 | -1.68 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
