rs7549840 chr1:157403206 C>A
- Sequence
tcaggattagcatctctgtagatc[C/A]aagaactcctgctgccttccttcc
- ASB in cell types
- iPS-derived dermal fibroblasts
- ASB for transcription factors
- CTNB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTNB1_HUMAN | -1.90 | 2.19 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), eye color, hdl cholesterol change with statins, infant head circumference, transmission distortion, triglycerides change with statins