rs7554486 chr1:8702298 G>A
- Sequence
caaacaatgcccacagagcgcggg[G/A]cacatgtgcgccagggacgcttaa
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 WS8 cells
- ASB for transcription factors
- MGAP_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MGAP_HUMAN | -3.01 | 3.06 | 1.00 | n/a | n/a | |||
| FOXA1_HUMAN | 0.81 | 0.53 | 1.73 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diabetic retinopathy in type 2 diabetes mellitus, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood