rs75561521 chr20:16737064 A>C
- Sequence
ttttaatctaataaacacacttga[A/C]tctaactttgtctaaattatgaat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | n/a | 2.30 | 1.00 |
Items per page:
1 – 1 of 1