rs7556644 chr1:171743728 C>A
- Sequence
gtctgtatatttgcatgttatggg[C/A]tattttctggctttggtgccttag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.23 | 1.07 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, homa-ir, hypertension (early onset hypertension), resistance to kuru in aged women despite likely exposure, schizophrenia, triglycerides, triglycerides change with statins
GTEx eQTL Brain_Cerebellar_Hemisphere, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg