rs75597695 chr5:78908376 G>C
- Sequence
aacaatctggagctaatttaagtg[G/C]tttaccatatcaggatacagctgg
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TCF21_HUMAN RUNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.77 | n/a | 2.00 | n/a | n/a | |||
| RUNX1_HUMAN | 1.96 | -1.61 | 1.00 | -4.62 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood