rs7560331 chr2:11124704 G>A
- Sequence
gcagtcatggccgacgtggacctg[G/A]caacctgctccgatcttcagaaat
- ASB in cell types
- WA09 (embryonic stem cells) GM02610 (Lymphoblastoid Cell Lines) foreskin keratinocyte MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 2.42 | 0.43 | 1.39 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 0.59 | -0.64 | 1.00 | |||
| foreskin keratinocyte | n/a | 0.57 | 2.67 | |||
| MS-1 (Small cell lung carcinoma) | -0.56 | 0.50 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.32 | 0.69 | 1.09 |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), microalbuminuria, refractive error, simpson-angus scale, years of education
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal