rs75627031 chr15:60917163 C>T
- Sequence
cagccttgggcacctacccgcctc[C/T]ccaaacagatgtaatttaggaaaa
- ASB in cell types
- 697 (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1))
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 697 (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1)) | 2.33 | -0.28 | 1.33 |
Items per page:
1 – 1 of 1