rs7563661 chr2:30274891 G>A
- Sequence
agagcttcaagaatcttggctatc[G/A]tccattcatcaacttggtcatcaa
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN394_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN394_HUMAN | 2.63 | -2.67 | 1.00 | n/a | No Hit | |||
| ESR1_HUMAN | 1.84 | -0.77 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP height, ldl cholesterol change with statins, mitral annular calcium, refractive error, rheumatoid arthritis, serum creatinine, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Minor_Salivary_Gland, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood