rs75646182 chr11:8338209 A>T
- Sequence
acagggcctggccaaggccagcat[A/T]ccggcttctgtgatccaggcacca
- ASB in cell types
- A549 (lung carcinoma) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.10 | 1.26 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.42 | -4.65 | 2.00 |
Items per page:
1 – 2 of 2