rs75689004 chr1:3900386 C>T
- Sequence
taagcggcgggcgaaggtcacagg[C/T]cttgggccagtggtgggacactgg
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma) CTV-1 (Adult T acute lymphoblastic leukemia) GM8330-8-derived NPC
- ASB for transcription factors
- MNT_HUMAN ANDR_HUMAN NRF1_HUMAN ZN639_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 1.77 | -0.12 | 1.25 | n/a | n/a | |||
| ANDR_HUMAN | 2.45 | -0.68 | 2.00 | n/a | No Hit | |||
| NRF1_HUMAN | 1.16 | -0.67 | 1.00 | n/a | No Hit | |||
| ZN639_HUMAN | 1.68 | -1.46 | 1.00 | n/a | n/a | |||
| ESR1_HUMAN | 1.65 | 1.51 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid